Tuesday, September 20, 2011

                                                                       Piltown Hoax

The Story began in 1912 near the Southern English town of Lewis in a village by the name of Piltown. There was a man by the name of Charles Dawson who was an ancient archeologist, one day while he was digging he found what he claimed to be an ancient piece of an human skull. He later invited England's leading geologist Arthur Smith Woodward, and a french  paleontologist, Father Pier. During that Summer they made more findings but one stck out in particular and that was what was said to be a human jaw bone. In December 1912 Charles made the the first public announcement on the findings and scientist applauded there discoveries. Up until this point only Asia, France, and Germany were suspected to have primitive fossils, now England  alas joined the club with these findings. Later on after WWII with new technology scientist could measure the fluorine content of fossils enabling to roughly be able to date fossils. After conducting these test in 1949 they showed that these fossils were rather young, 100,000 years young which made no sense. So in 1953 scientist conducted a full scale analysis with better dating methods, and which this evidence showed that there was fake staining on the bones and artifacts. Using a microscope they also found that the teeth were filled down, the jaw bown dated back less than 100 yrs and was from a female orangoutang.
This Hoax was not initially caught becasuse the scientist that were involved were so quick to say they found  fossils without searching for more evidence, if there was a piece of a skull and a jaw bone there would have surely been more pieces to complete the skull fossil. This negatively messed up the scientific process because they did not ask other researchers to compare there fossils with the fossils from other similar areas to make sure it was an actual human skull. The positive parts of the scientific process however were used when the actual testing using fluorine to show aging in the bones and the use of a microscope to show that the teeth were filled.
The Human factor in science will always be an issue in science, when you discover something that goes against the odds or other known facts you will do whatever it takes to make them true until an actual test is conducted and it makes it false so you may renew your hypothesis. I think the human factor is good for science, it keeps the scientist working and researching. With this whole story of the "Piltown Hoax" i've learned you should take everything with a grain of salt when someone is challenging or showing you something new because it could be fake. Wait until you here from other official sources and or do your own research to kind of get an idea of what you just saw.      

Wednesday, September 14, 2011

1. Compare the expression of one particular type of trait across five categories of primates, specifically comparing a designated representative of each category. 


Lemurs (Prosimians/Strepsirhini)
Spider Monkey (New World Monkey/Platyrrhini)
Baboon (Old World Monkey/Cercopithecidae)
Gibbon (Lesser ape/Hylobatidae)
Chimpanzee (Great ape/Hominidae 


1. These primates that i have studied all have LARGE EYES that are placed in the frontal parts of there face which causes binocular vision, each sends visual information to both hemispheres of the brain, enhancing depth perception and producing Stereoscopic Vision. Which means they can see an object wit their two eyes at the same time on the same plane, humans have Stereoscopic Vision as well. 


2. Sociality and Mating patterns  


Prosimians/Strepsirhini 


  


This Group can only be found in Madagascar and the comoro islands, Lemurs are found in social groups ranging in size from three to 25 individuals. The groups have both males and females. Females remain in their birth group throughout their lives and males generally change groups when they reach sexual maturity, at age three. Females are the dominant ones in the group, they choose who they want to mate with and have access to the foods the would like. The Females tend to mate with the male who has the hierarchy, but even the lower ranking males are able to find mates.  A little fun fact is that Lemurs like sunbathing. 

Spider Monkey (New World Monkey/Platyrrhini) 


    

There is a large community of  these individuals that regularly associate with one another but individuals within the larger community spend much of their time traveling in smaller, temporary sub-groups led by dominant adult female, the average group is three individuals, most commonly an adult male, and an adult female, and her dependent offspring spider monkey knows when to reproduce by watching at the female monkey getting her cycle to start to reproduce. The female monkey has a monthly cycle from 24 to 27 days long. Mating occurs from 2 to 3 days. If they don't stay together for the length of 3 days then no baby can be conceived. Monkeys usually mate when they are mature enough. The male becomes sexually mature at the age of 5 and the female at the age of 4. The spider monkey is ready to let go of her baby when it is 15 months old. The mother carries her young from 6 to 15 months.

Baboon (Old World Monkey/Cercopithecidae) 


   


Different kinds of baboons that live in very different habitats tend to differ in group size ranging from 10 to 200!! Baboons live their entire lives in close proximity not only to friends and family but also to opponents. For a male who may live in several different groups over the course of his life, this situation is not so great. But for female baboons,  her relationships with other females are good, they actually have friendships with one another, which is cool. Females Ranking high can displace  lower ranking females from food and water sources. For high ranking males its effects you for how many offspring you leave behind. This is because high-ranking males manage to form sexual consortships with females more successfully than low-ranking males do. Its like marriage. But this means lower ranking males have more sexual options.

Gibbon (Lesser ape/Hylobatidae)  
     


Gibbons live in small, monogamous families composed of a mated pair and up to four offspring. Less than six percent of all primate species (more than 300) are considered monogamous! The Females are Dominant in the group. The female leads the group frequently, especially in initiating calls, directing the group along its route, and entering and leaving sleeping trees. Males most often lead activities such as looking out for danger and entering territorial disputes  Members of both sexes lead movements into food trees when the food supply is abundant.

Chimpanzee (Great ape/Hominidae)  


   

The common chimpanzee has a fission-fusion society, and the groups at any one time could be of the following types: all-male, adult females and offspring, bisexual, one female and her offspring, and single individual. This species has a promiscuous mating system. . The core of the society are the males, who roam around and protect members of the group as well as hunt. Sometimes an adult male kills the infant of an unfamiliar female,  male-male associations are the strongest in the group, with grooming and food sharing occurring between males Within the male hierarchy, alpha status is often gained through forming coalitions with a brother or an older non-relative. Male chimps can start to reproduce at 16 years of age,

I've found that with theses traits, these primates tend to be close knit with one another, they seem to always want to be around one another either helping with getting food, grooming one another or just for company. There environments are always close to where the food is as well, they do not do much traveling. The females in these groups seem to be the nay sayers, not so much for the Chimps though. I noticed for the type of environment each group, each were always around trees, which is why they all have hands that can grip branches and grab fruits from trees our pick up insects for the group that has insect in there diet.

Thursday, September 8, 2011

Homologous/Analogous Traits

1. For your homologus traits provide the following information 
a. Briefly describe the two different species that possess the homologous trait.

a) The Human and Alligator share Homologus trait of  forelimbs. You can find the, Radius, ulna, humerous and carpals in there anatomy. Even though the outside appearance is different and the functions differ, there skeletal structure is similar.    

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete.

b)  The human arm consist of three large bones. The humerus bone forms the upper arm. The radius and ulna are the two bones forming the lower arm. You have one radius and one ulna in each arm. The radius and ulna bones connect between the elbow joint and the wrist. Which is why humans can bend and straighten their arms to full lengths which is something an Alligator cannot do. Alligators do not need to extend their arms because there mobility is usually in water where there tail comes into play.  Relationship between limbs and body is that reptiles have their upper limbs jutting out from the body, while mammals (humans) have their limbs in line with the body, supporting and more easily raising the body mass off the ground.

. c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?

Common ancestor for these two species was the dinosaur,  each species has vertebrates, which is the central component of the skeleton. They all share forelimbs. They have a protective membrane, called an amnion, surrounding their eggs. The amnion allows the egg to survive outside of an aquatic environment. In humans, the egg develops inside the mother's body which is how which differs from the hard shelled egg of an alligator. These are reasons in which i know they are common ancestors.  

.. d. Provide an image of each species in this comparison. 
Human Arm
    
Alligtor arm (5,6,7,8)


2. For your analogous traits provide the following information 
a. Briefly describe the two different species that possess the analogous trait.  

a) Butterfly wings and bat wings are examples of analagous structures because both have structural similarities they both evolved for the same task, flight, but these species do not share a common ancestor. Bat wings have bones, Butterfly wings do not.  

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. 

Butterflies wings do not share similarities in structure with bat wings, their similarity comes from performing the same Function. Butterflies have big long wings used for gliding when they migrate, bats have big long wings as well but they differ it structure but they help when migrating as well. Like butterflies a bats wings are its most distinctive feature. 

c. All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not? 
 
The Butterfly and Bat share only a common function and did not arise from an ancestral structure.  

d. Provide an image of each species in this comparison.  

Buttterfly
    

Bat: 

Thursday, September 1, 2011

PROTEIN SYNTHESIS

PROTOTEIN SYNTHESIS: DNA STRAND    


AUGAAUCAAUAUACCCUUUUGCCAGACUUAG

Thursday, August 25, 2011

Charles Lyell

1) Charles Lyell had had the most influence over Darwin’s development of his theory of Natural selection.

2) Charles Lyell, a British lawyer-turned-geologist (1797-1875) wanted to change the face of geology, he didn't want it to be about any wild speculations or for the supernatural to be the underlying reason for its existence. He wanted it to be a true science of hits own, just like Darwin. In Darwin's day it was thought the apperence of species was a "Mystery upon Mysteries" but that wasn't a good enough explanation for him. Lyell traveled through Europe to find more evidence that gradual changes had produced the features of the Earth's surface. And through his studies and explorations he was able to change the face of geology with actual rock hard evidence. (haha/joke..) (http://evolution.berkeley.edu/evolibrary/article/history_12)


From this bullet point - 

  • 3) If the environment changes, the traits that are helpful or adaptive to that environment will be different.  Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population.  This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful.


With Lylle's area of study (Geology) natural selection does apply. But it does go hand in hand with Darwin's work because it deals with environment. So Lylle's work was very positive effect on Darwins work.  


4) Without Lylle Darwin could not have developed his theory of natural selection as throughly as he would have liked to i believe. With Lylle actually being on voyages with Darwin he was able to decipher the history of islands, which gave Darwin a better perspective of what type of species would be in that area.  


5) Its seems during that time the church had most of the power, and if anyone went against or even challenged there beliefs they were frowned upon. Being that Darwin came from a respectable family he didn't want his writings to affect his family or others in the wrong way, so i believe he waited until he had more evidence and findings to then create his wonderful book " The Origins of Speacies 

Evolution of skulls